Characterization of genes related to the efflux pump and porin in multidrug-resistant Escherichia coli strains isolated from patients with COVID-19 after secondary infection

Table 1 Primer sequences, product sizes, and annealing temperatures of target genes of the isolates used in this study

Genes	Primer sequences (5′-3′)	Product size (bp)	Annealing temperature (°C)	References
acrA	F: ggtcgttctgatgctctca	1078 bp	52 °C	[35]
acrA	R: ggcttgctggttattatcag	1078 bp	52 °C	[35]
acrB	F: cgtctaacagtgactccacgg	2730 bp	52 °C	[35]
acrB	R: ttcaatcagacctttaccttc	2730 bp	52 °C	[35]
tolC	F: atgcaaatgaagaaa	100 bp	49 °C	[35]
tolC	R: ttaatgacggaacggatt	100 bp	49 °C	[35]
ompF	F: ggtctgcgtccgtccat	99 bp	60 °C	[36]
ompF	R: ggttgcgcccacttca	99 bp	60 °C	[36]
ompC	F: aagtagtaggtagcaccaacatca	163 bp	60 °C	[36]
ompC	R: gggcgaacaaagcacagaa	163 bp	60 °C	[36]

ISSN: 1471-2180