Detection of hemolytic Shiga toxin-producing Escherichia coli in fresh vegetables and efficiency of phytogenically synthesized silver nanoparticles by Syzygium aromaticum extract and gamma radiation against isolated pathogens

Table 1 Primers sequences, target genes, amplicon sizes and cycling conditions

Target gene	Primers sequences	Amplified segment (bp)	Primary denaturation	Amplification (35 cycles)			Final extension	Reference
Target gene	Primers sequences	Amplified segment (bp)	Primary denaturation	Secondary denaturation	Annealing	Extension	Final extension	Reference
E. coli phoA	CGATTCTGGAAATGGCAAAAG	720	94˚C 5 min	94˚C 30 s	55˚C 40 s	72˚C 45 s	72˚C 10 min	[27]
E. coli phoA	CGTGATCAGCGGTGACTATGAC	720	94˚C 5 min	94˚C 30 s	55˚C 40 s	72˚C 45 s	72˚C 10 min	[27]
Stx1	ACACTGGATGATCTCAGTGG	614	94˚C 5 min	94˚C 30 s	58˚C 40 s	72˚C 45 s	72˚C 10 min	[28]
Stx1	CTGAATCCCCCTCCATTATG	614	94˚C 5 min	94˚C 30 s	58˚C 40 s	72˚C 45 s	72˚C 10 min
Stx2	CCATGACAACGGACAGCAGTT	779	94˚C 5 min	94˚C 30 s	58˚C 40 s	72˚C 45 s	72˚C 10 min
Stx2	CCTGTCAACTGAGCAGCACTTTG	779	94˚C 5 min	94˚C 30 s	58˚C 40 s	72˚C 45 s	72˚C 10 min

ISSN: 1471-2180