Skip to main content

Table 3 Primers and PCR protocols

From: A new strain of Volutella citrinella with nematode predation and nematicidal activity, isolated from the cysts of potato cyst nematodes in China

Target DNA Primer Primer sequence 5′–3’ PCR protocol
LSU rDNA LR0R
LR5
ACCCGCTGAACTTAAGC
TCCTGAGGGAAACTTCG
95 °C for 3 min; 31 cycles of 94 °C for 30 s, 50 °C for 45 s, and 72 °C for 1 min 30 s; 72 °C for 7 min; and 4 °C on hold
ITS rDNA ITS5
ITS4
GGAAGTAAAAGTCGTAACAAGG
TCCTCCGCTTATTGATATGC
95 °C for 3 min; 31 cycles of 94 °C for 1 min, 50 °C for 45 s, and 72 °C for 3 min; 72 °C for 7 min; and 4 °C on hold
  1. Note: The primers were synthesized by SinGenoMax (Beijing)