Molecular signatures of Janthinobacterium lividum from Trinidad support high potential for crude oil metabolism

BMC Microbiology

Table 1 Primer specifications designed to amplify the VioA and EstA/B genes of Janthinobacterium sp.

Primer name	Primer orientation	5′ to 3′ Primer sequence	Start nucleotide position	Primer length	Tm^a	% GC	PCR product/bp
VioA gene-Janthino	Forward Primer	TCGAGTTCGTCAGCCATTAC	365	20	61.7	50
VioA gene-Janthino	Reverse Primer	CTTCTTCTTCCGTCCGTTGA	1264	20	61.7	50	900
EstA/B-Janthino	Forward Primer	GTTGATGCTGCTGCAAGTG	24	19	61.9	52.6
EstA/B-Janthino	Reverse Primer	TGTCGTGATGCGAATAGATCG	784	21	62.1	47.6	761

ISSN: 1471-2180