Skip to main content

Table 1 Primer specifications designed to amplify the VioA and EstA/B genes of Janthinobacterium sp.

From: Molecular signatures of Janthinobacterium lividum from Trinidad support high potential for crude oil metabolism

Primer name Primer orientation 5′ to 3′ Primer sequence Start nucleotide position Primer length Tma % GC PCR product/bp
VioA gene-Janthino Forward Primer TCGAGTTCGTCAGCCATTAC 365 20 61.7 50  
Reverse Primer CTTCTTCTTCCGTCCGTTGA 1264 20 61.7 50 900
EstA/B-Janthino Forward Primer GTTGATGCTGCTGCAAGTG 24 19 61.9 52.6  
Reverse Primer TGTCGTGATGCGAATAGATCG 784 21 62.1 47.6 761
  1. aTm PCR annealing temperature