Skip to main content

Table 3 PCR primers used in this study

From: Increased whiB7 expression and antibiotic resistance in Mycobacterium chelonae carrying two prophages

Description Primers Sequence (5' to 3') Tm (˚C) % GC amplicon size (bp)
Primers used to detect McProf phage attachment sites in M. chelonae Mc_attL_F CGTCACGTTGGGGACTATCT 56.5 55 212
Mc_attL_R TTGAGCTGCGGATAACCTCT 56 50
Mc_attR_F CGCTTGTAATCGTCGTCGTA 54.7 50 1067
McProphageRR ATAACTTTCGGCGGTTCCTT 54.5 45
Primers used to detect BPs phage attachment sites in M. chelonae BPs_attP_L GCTTTATCCAGGGTTGACCA 54.8 50 203
BPs_attP_R GTTCCGATTAGTTGGCTGGA 54.8 50
BPs_attB_L GTCTCGTTACTGGCGAGCTT 57.1 55 548
BPs_attB_R CGGGTAGTAGGCAGATGAGC 57.2 60