Skip to main content

Table 2 Primers targeting the bacterial 16S rRNA gene for HRMA

From: Efficacy of 16S rRNA variable regions high-resolution melt analysis for bacterial pathogens identification in periprosthetic joint infections

Region Primer Sequence (5′-3′) Product size (bp) Ref
V1 V1-F
V1-R
GYGGCGNACGGGTGAGTAA
TTACCCCACCAACTAGC
170–171 [49]
V3 V3-F
V3-R
CCAGACTCCTACGGGAGGCAG
CGTATTACCGCGGCTGCTG
204–205
V6 V6-F
V6-R
TGGAGCATGTGGTTTAATTCGA
AGCTGACGACANCCATGCA
128–131