Skip to main content

Table 3 Oligonucleotides used in the current study

From: Utilization of L-glutamate as a preferred or sole nutrient in Pseudomonas aeruginosa PAO1 depends on genes encoding for the enhancer-binding protein AauR, the sigma factor RpoN and the transporter complex AatJQMP

Oligonucleotides Sequence Purposea
BL342.r gcagttatttttgacaccagaccaactggta E. coli lacZ
JS05.r tgaatccgtaatcatggtcatgttggggtttcccctcgg aatQ-lacZ
JS06.f ccgaggggaaaccccaacatgaccatgattacggattcactgg E. coli lacZ (aatQ overlap)
JS42.f ccgaggggaaaccccaacatgaccatgattacggattcactgg E. coli lacZ (aatJ overlap)
JS43.r tgaatccgtaatcatggtcatgaatttcttcctcgacttgttttg aatJ-lacZ
JS35P.f cgtctcctgtcgagtgacgaacc aatJ-lacZ and aatQ-lacZ
JS50.f gcatctagaccgccagtgtctgcaacc aatQMP genes
JS51.r gcagagctctcagtgcgggaggatcttgg aatQMP genes
JS391K.f aggaacttcaagatccccaattcgggaaatggtcaacgaagtgctcg aatQM DnF-Gm
JS391K.r tacaagaaagctgggtgatcttggcgaggaactgc aatQM DnR-GWR
JS401K.f tacaaaaaagcaggctggacttcagtggaatcgttcc aatQM UpF-GWL
JS401K.r tcagagcgcttttgaagctaattcgcgatgttcgacagcaacttgc aatQM UpR-Gm
JS351.f tacaaaaaagcaggctggaggagctggaggacatc aauR UpF-GWL
JS351.r tcagagcgcttttgaagctaattcggatgatccgttgcgccagg aauR UpR-Gm
JS352.f aggaacttcaagatccccaattcggaacacttcctccagcagtc aauR DnF-Gm
JS352.r tacaagaaagctgggtgcaggccgtacttcttcac aauR DnR-GWR
JS100.f tacaaaaaagcaggctccggatttcataagctggc aatJ UpF-GWL
JS100.r tcagagcgcttttgaagctaattcgggtaggagaagggaatcgaagc aatJ UpR-Gm
JS101.f aggaacttcaagatccccaattcggcgaggtcaacaagatctacg aatJ DnF-Gm
JS101.r tacaagaaagctgggtcctcggttcaatcggttgc aatJ DnR-GWR
JS111.f gcactcgaggccggggaaaaccgcgaaacaccc aatJ gene
JS111.r gcatctagattacatctgctcggcggccttgtcgg aatJ gene
JS117.f gcaggatccccggggaaaaccgcgaaacaccctgtccc aatJQMP genes
JS117.r gcatctagatcagtgcgggaggatcttggcgaggaactgc aatJQMP genes
JS118.f gcatctagagcatgtcttgctcggctgccagcaggc aauR gene
JS118.r gcagagctccccggcctattgcaggccgtacttcttcaccttgtcg aauR gene
  1. aNote that oligonucleotides used in the cloning of gene-deletion plasmids were designated as DnF-Gm, DnR-GWR, UpF-GWL or UpR-Gm in accordance with the original methods publication [43]