Skip to main content

Table 2 Oligonucleotides used in the study

From: FixJ family regulator AcfR of Azorhizobium caulinodans is involved in symbiosis with the host plant

Primer name Sequence (5′-3′)a Purpose
AcfR-UF-KpnI GGGGTACCCTGATGACCCTCAGCCAGTTG ΔacfR mutant construction
AcfR-UR-NdeI TCCATATGTGGATCGTTTGACGAGGTCAC ΔacfR mutant construction
AcfR-DF-ApaI TCGGGCCCGAGACGCGTCGGAATTCCTGA ΔacfR mutant construction
AcfR-DR-AgeI CGACGCGTAATGGCGATGCCAACTACCGA ΔacfR mutant construction
AcfR-CF-KpnI GGGTACCTGGGTGCGACGCTA TCACGGA ΔacfR-C construction
AcfR-CR-BamHI CGGGATCCCTGACGGCAGACATCGAAACG ΔacfR-C construction
AcfR-F GTGACCTCGTCAAACGATCCA Validation of acfR
AcfR-R TCAGGAATTCCGACGCGTCTC Validation of acfR
  1. aEngineered restriction sites are underlined