Skip to main content

Table 2 Oligo nucleotides used in this study

From: Two novel XRE-like transcriptional regulators control phenotypic heterogeneity in Photorhabdus luminescens cell populations

Name Oligo sequence 5′ → 3′
BamHI-xreR2-FA fwd GCCGGGATCCGTACTTATCAGTTACCACCAACCC
xreR2-FA-ovl-FB rev CGTCAGTAGATCCATTAATTAATCCTCCGTGTTAC
xreR2-FB-ovl-FA fwd GATCTACTGACGTAGGTGGCTGTAAATTAAAGTGG
xreR2-FB-EagI rev ATCCCGGCCGGCGCTTCAACTAAAGGAATAGCC
EcoRI-xreR1-FA fwd GCCGGAATTCGGTTATCTGAACGATCCTGAAC
xreR1-FA-ovl-FB rev ATCTGTATCGCGCATTCGATAAGTATCGAACGATG
xreR1-FB-ovl-FA fwd CGCGATACAGATTAGTGATCTATACCTTATGG
xreR1-FB-EagI rev ATCCCGGCCG GAAATTGCGCTCGTTACTGCTG
PstI-lacI_Ptac fwd GCGCTGCAGCATTAATTGCGTTGCGCTCA
Ptac-ovl-blank rev ATCTGTATCGCGAGAATTCCCTCCTGTGTGAAATTG
xreR2-ovl-Ptac fwd TCGCGATACAGATATGAAAAATCAAGACTGGCACC
xreR2-EagI rev ATCCCGGCCGCTACTTTGTGTACCTCGAAGGCC
xreR1-ovl-Ptac fwd TCGCGATACAGATATGAAAAAACCTAACACGATAAAATC
xreR1-EagI rev ATCCCGGCCGCTAACTCTTTTTCTCCGCGTC
BamHI-FA 4295 fwd GCCGGGATCCCTTATCAGACCACGGACTATGAG
FA ovl FB 4295 rev CGTCAGTAGATCCATAGCACACCTCAGAAACAC
FB ovl FA 4295 fwd GATCTACTGACGTAAATGCAATTTGTTGTTTATC
FB 4295-EagI rev ATCCCGGCCGCAACGCTGGGCGCAGGCAAACCTAC).
BamHI-FA 4296 fwd GCCGGGATCCGCATCATCGACCCTTGCCAATAC
FA ovl FB 4296_rev CGTCAGTAGATCTTACCAGTTCCTGTTTTCATC
FB ovl FA 4296 fwd GATCTACTGACGTCAGTTTTCTTCATTTGTGCCGCTCTG
ccdB-like ovl Ptac fwd TCGCGATACAGATATGCAATTTGTTGTTTATC
ccdB-like-EagI rev ATCCCGGCCGTTACAGAAAAATATTCATACAG
NheI-ccdB-like fwd GCTGCTAGCATGCAATTTGTTGTTTATC
ccdB-like-XmaI rev CAGCCCGGGTTACAGAAAAATATTCATACAG
check-pNPTS fwd TGCTTCCGGCTCGTATG
check-pNPTS rev GTAAAACGACGGCCAGTCC
check-pPINT fwd CCGTTCTGTGCGAATCGTGGAG
check-pPINT rev GGCCATTGGCACTGATTG
check-pBAD24 fwd GCCGTCACTGCGTCTTTTACTGG
check-pBAD24 rev CGCTACGGCGTTTCACTTCTG
Cy5-PxreR2 fwd [Cy5] CTGATAAGTATCGAATGATGTTAC
PxreR2 rev GGGTGCCAGTCTTGATTTTTC
Cy5-PxreR1 fwd [Cy5] CTTAATAAATAATACTTGCGACCAGATTGG
PxreR1 rev CGTGTTAGGTTTTTTCATTCGATAAG
Cy5-PpTAS fwd [Cy5] GTGGCTGTAAATTAAAGTGGAGTAG
PpTAS rev GTTTCATAGCACACCTCAGAAAC
Cy5-PantA fwd [Cy5] TAATGCAGAAATTATTGCT
PantA rev CTGAACTATTCCTATCGTTA
Cy5-PpluxC fwd [Cy5] TTTGTATATAAAGAAGAGCTTG
PluxC ATTAGCCATCCATTTAATG
Cy5-fryB-300 fwd [Cy5] GGTGTATCTCATCGTCCATGACAAT
fryB −0 rev TTGAATTCCGTTAATTCCTCGTTCAG
Btn-PxreR2 fwd [Btn] CTGATAAGTATCGAATGATGTTAC
Btn-PxreR1 fwd [Btn] CTTAATAAATAATACTTGCGACCAGATTGG
Btn-PpTAS fwd [Btn] GTGGCTGTAAATTAAAGTGGAGTAG
BamHI_xreR1 fwd GCTGGATCCGATGCAATTTGTTGTTTATC
BamHI_xreR2 fwd CTGGATCCATGAAAAATCAAGACTGGCACCC
xreR1_XmaI rev CAGCCCGGGTTACAGAAAAATATTCATACAG
xreR2_XmaI rev CAGCCCGGGCTACTTTGTGTACCTCGAAGGC