Skip to main content

Table 1 Primers sequences and PCR protocols used in this study

From: Helicobacter pylori 23S rRNA gene A2142G, A2143G, T2182C, and C2195T mutations associated with clarithromycin resistance detected in Sudanese patients

Protocols Primer name Primer sequence (5′-3′) Amplicon size (bp References
1st 16 s RNA GCTAA GAGA TCA GCC TAT GTCC
TGGCAATCAGCGTCAGGTAATG
532 [18]
2nd FP-1 TCGAAGGTTAAGAGGATGCGTCAGTC 320 [19]
RP-1 GACTCCATAAGAGCCAAAGCCCTTAC
RP2142G AGTAAAGGTCCACGGGGTATTCC 238
FP2143G CCGCGGCAAGACAGAGA 118