Skip to main content

Table 2 Primers used for hpa1 deletion mutant constructions

From: The stability of the coiled-coil structure near to N-terminus influence the heat resistance of harpin proteins from Xanthomonas

Primer names Primer sequence (5′-3′) Purpose
HpaXmΔL39A-F CATCTCGGAAAAGCAGGCCGACCAGCTGCTGACCC Primers used to construct hpaXmΔL39A
HpaXmΔL39A-R GGGTCAGCAGCTGGTCGGCCTGCTTTTCCGAGATG
Hpa1XooΔD41A-F CTCGGAAAAGCAACTGGCTCAGTTGCTGTGCCAGC Primers for constructing hpa1XooΔD41A
Hpa1XooΔD41A-R GCTGGCACAGCAACTGAGCCAGTTGCTTTTCCGAG
HpaXpmΔM54A-F ACACAGCTCATCATCCTGGCCCTGCTGC Primers for constructing hpaXamΔM54A
HpaXpmΔM54A-R GGATGATGAGCTGTGTCAGCAACTGGTC
HpaXcmΔL40A-F CATCTCGGAAAAGCAAGCCGACCAGCTGCTGACCC Primers for constructing hpaXcmΔL40A
HpaXcmΔL40A-R GGGTCAGCAGCTGGTCGGCTTGCTTTTCCGAGATG