Skip to main content

Table 2 PCR primers used in this study

From: S-layer associated proteins contribute to the adhesive and immunomodulatory properties of Lactobacillus acidophilus NCFM

Primer Name Sequence*
Construction of deletion mutants
 0046HindIIIF GATCTAAAGCTTGCTCAACATTATTAACGGTTC
 0046R TTCTAACATAATGAATACCTCGTA
 0046Soe AGGTATTCATTATGTTAGAAGACTAATCTAGATCAAGATTCATCA
 0046SacIR GATCTAGAGCTCCATACTACTTCTGCGTCTTC
 0864HindIIIF GATCTAAAGCTTCTGCTGATATTGATGCAGTGAGTGG
 0864R CGCACCGGCAATAACTATTCCCTTAAT
 0864Soe AAGGGAATAGTTATTGCCGGTGCGCGTGCAGAATTAACTCAAGGTCGC
 0864SacIR GATCTAGAGCTCCGTGCACTTGACACAGATCCTG
 1426HindIIIF GATCTAAAGCTTTATAGATTAATTGACTGCAGCC
 1426R CGCTGCCATTGAAGTAATTA
 1426Soe TAATTACTTCAATGGCAGCGAACTAATCTATTAATGAAGAAACTCGT
 1426SacIR GATCTAGAGCTCCTTATCGTTCATGCCAAGAA
 1539BamHIF GATCTAGGATCCATCACTTGATCGATCATCTG
 1539R CTTCATCTGAATATCTCCTCT
 1539Soe AGAGGAGATATTCAGATGAAGTTGATAAAATAATCTACTACTTTGTGA
 1539SacIR GATCTAGAGCTCCTCTTAGGTGCAAGCATTAA
PCR analysis and DNA sequencing of deletion targets
 0046up CTATCTGTATGATGCTTCCAC
 0046dw GTACCTCAATCTGTTGTAATCTC
 0864up ACAAGCTAGAGGTATGGCTGG
 0864dw CCACATGAATGGCGTATGGC
 1426up AAGCCGTTGTATTGAATGATGGTAG
 1426dw CGCGAATCATCAATTCACGGTA
 1539up CAGGATAGGGATGCACATGC
 1539dw CGACGTTGACGTGTTACTGT
  1. *The primers, the 5′-to-3′ sequences are given and restriction enzyme sites are underlined