Skip to main content

Table 1 Blocking and excluding primers used for metabarcoding analyses

From: Unveiling protist diversity associated with the Pacific oyster Crassostrea gigas using blocking and excluding primers

Marker region Target Forward (5′- > 3′) Reverse (5′- > 3′) Blocking primer (5′- > 3′)
18SV4 Eukaryota CCAGCASCYGCGGTAATTCC ACTTTCGTTCTTGATYRA TCTTGACTAATGAAAACATGCTTGG
18SV1V2 Non-metazoa ACCTGGTTGATCCTGCCA GTARKCCWMTAYMYTACC No blocking primer