Skip to main content

Table 1 Primers and conditions used in qPCR quantification of microbial cultures

From: Biofilm growth and IL-8 & TNF-α-inducing properties of Candida albicans in the presence of oral gram-positive and gram-negative bacteria

Species Primer sequence 5′-3′ Annealing temperatures
(°C)
References
A. actinomycetemcomitans F: TAGCCCTGGTGCCCGAAGC
R: CATCGCTGGTTGGTTACCCTCTG
68 [61]
S. mutans F: TCGCGAAAAAGATAAACAAACA
R: GCCCCTTCACAGTTGGTTAG
56 [62]
S. gordonii F: GGTGTTGTTTGACCCGTTCAG
R: AGTCCATCCCACGAGCACAG
53 [63]
C. albicans F: TCA ACT TGT CAC ACC AGA TTA TT
R: TCC TCC GCT TAT TGA TAT GC
52 [64]