Skip to main content

Table 1 Specific primers of quantitative real-time PCR

From: Effects of resveratrol on cariogenic virulence properties of Streptococcus mutans

GeneaPrimer sequence(5′-3′)Description
ForwardReverse
16S rRNAAGCGTTGTCCGGATTTATTGCTACGCATTTCACCGCTACANormalizing internal standard
ldhGGCGACGCTCTTGATCTTAGGGTTAGCAGCAACGAGGAAGLactate dehydrogenase
relAACAAAAAGGGTATCGTCCGTACATAATCACGCTTGGTATTGCTAATTGGuanosine tetra (penta)-phosphatesynthetase
gtfCGGTTTAACGTCAAAATTAGCTGTATTAGCCTCAACCAACCGCCACTGTTWater soluble and insoluble glucan production
comDEACAATTCCTTGAGTTCCATCCAAGTGGTCTGCTGCCTGTTGCCompetence-stimulating peptide
  1. aBased on the NCBI S. mutans UA159 genome database