Skip to main content

Table 1 Primers used in the simplex PCR for the detection of virulence genes in B. cereus

From: Toxigenic potential and antimicrobial susceptibility of Bacillus cereus group bacteria isolated from Tunisian foodstuffs

Targeted Gene Primer name Sequence (5′- 3′) Product Size (bp) Annealing Temp (°C) Reference
hblA HA F
HA R
AAGCAATGGAATACAATGGG
AGAATCTAAATCATGCCACTGC
1154 56 [33]
hblB HA F
HB R
AAGCAATGGAATACAATGGG
AATATGTCCCAGTACACCCG
2684 58 [33]
hblC HC F
HC R
GATACTCAATGTGGCAACTGC
TTGAGACTGCTCGTCTAGTTG
740 58 [33]
hblD HD F
HD R
ACCGGTAACACTATTCATGC GAGTCCATATGCTTAGATGC 829 58 [33]
nheA NA F
NA R
GTTAGGATCACAATCACCGC
ACGAATGTAATTTGAGTCGC
755 56 [33]
nheB NB F
NB R
TTTAGTAGTGGATCTGTACGC
TTAATGTTCGTTAATCCTGC
743 54 [33]
nheC NC F
NC R
TGGATTCCAAGATGTAACG ATTACGACTTCTGCTTGTGC 683 54 [33]
bceT bceT-f
bceT-r
GCTACGCAAAAACCGAGTGGTG
AATGCTCCGGACTATGCTGACG
679 57 [12]
cytK CK F
CK R
ACAGATATCGG(G,T)CAAAATGC
TCCAACCCAGTT(A,T)(G,C) CAGTTC
809 54 [11]
cytK-1 CK1 F
CK1 R
CAATTCCAGGGGCAAGTGTC
CCTCGTGCATCTGTTTCATGAG
426 57 [11]
cytK-2 CK2 F
CK2 R
CAATCCCTGGCGCTAGTGCA
GTGIAGCCTGGACGAAGTTGG
585 57 [11]
ces EM1F
EM1R
GACAAGAGAAATTTCTACGAGCAAGTAAT
GCAGCCTTCCAATTACTCCTTCTGCCACAGT
635 58 [34]
CesF1
CesR2
GGTGACACATTATCATATAAGGTG
GTAAGCGAACCTGTCTGTAACAACA
1271 58 [35]