Skip to main content

Advertisement

Table 3 Sequences of the primers used in this study

From: The impact of sseK2 deletion on Salmonella enterica serovar typhimurium virulence in vivo and in vitro

Primer Primer sequences Restriction site
ΔsseK2-up-F 5′-TCTAGAATAGAAGAGGCCCAAAGA-3’ Xba I
ΔsseK2-up-R 5′-GGATCCATTTTTACACGCTTAAATTA-3’ BamH I
ΔsseK2-down-F 5′-CTCGAG TCATGATAGCCTTGTTTTAC −3’ Xho I
ΔsseK2-down-R 5′-GGTACC ACACGGCGCACTATTAGA-3’ Kpn I
sseK2- F 5′-ACCACACTAACCAAAGCGCA-3’  
sseK2 -R 5′-GCAGAGAATAATGGACCACAT-3’  
pBR -sseK2-F 5′-GGATCCATGGCACGTTTTAATGCC-3’ BamH I
pBR -sseK2-R 5′-CTCGACTTACCTCCAAGAACTGGCAG-3’ Sal I