Skip to main content

Advertisement

Table 1 Primer sequences for analysis of gene expression using qRT-PCR

From: Transcriptome analysis of responses to bluetongue virus infection in Aedes albopictus cells

Primer name Sequence (5′-3′) Product size (bp)
AAEL015390-F AGGCGAAAGCCAAAGCAGTT 90
AAEL015390-R TCGTGCGGTTCTTCAGGTGT
AAEL010126 -F TCCACCTCGTCGTCACCTTG 131
AAEL010126-R TGTTCGTCGTAGCTGTCGCT
AAEL009532-F CTGCTGTTCCACACGCTGAC 189
AAEL009532-R TAACCGCGCTCTCCGAATGT
AAEL001603-F GCTGCCCATCCAGAACAAGC 163
AAEL001603-R GGTGCGGCCACTGTATGTTG
AAEL012071-F GCGCGTCAAAGATGCAGAGG 166
AAEL012071-R GAAGGCATCGTCGACTCCCA
AAEL001165-F ACAGTTCGGCCAACTCGTCA 149
AAEL001165-R ACTGGCTGTTGGTGACTGCT
AAEL002903-F TTTGCGCACCATCCAAGACG 139
AAEL002903-R GTGCCCAATGTGCTGGTTGT
AAEL004715-F CGACGGGTAGCAGTAGCTGT 150
AAEL004715-R TGTTGTGCTTGCTCTGCGTT
AAEL010488-F CCGTCTCCCAGTCACCTGTC 163
AAEL010488-R CGTCATCCTGTTGGCTGTGC
β - actin-F GGAGAAGATCTGGCATCACA 95
β - actin-R TGTCATCTTCTCGCGGTTAG