Skip to main content

Advertisement

Table 2 Primers used in this study

From: Carbohydrate metabolic systems present on genomic islands are lost and gained in Vibrio parahaemolyticus

Primer name and use Sequence (5′-3′)a Melting temp (°C)
SOE PCR
 VP0065 SOEA TCTAGAAACCGTAGCGCTAACCACTA 63
 VP0065 SOEB AATGTCACTTCCGCACATGG 59
 VP0065 SOEC CCATGTGCGGAAGTGACATTTGCAATGATGGATAACGGCG 59
 VP0065 SOED GAGCTCCAGGCCCCAATTTTGAGACC 60
 VP0065 SOEFF GTGTGGTGAGTCATTGGCTC 55
 VP0065 SOEFR GCCAATGCGTACGACAAAGA 50
 SGLT SOEA TCTAGACTTCTACCCTTTGAACTTGCAG 58
 SGLT SOEB GACATAAATGGCGAAGACC 51
 SGLT SOEC GGTCTTCGCCATTTATGTCATCGCTGCTTACGGCATAAT 66
 SGLT SOED GAGCTCGGTTTGTATGCACCACCCAC 63
 SGLT SOEFF GGTGAAAACCACCAAACCTG 55
 SGLT SOEFR TGAGGATGGGCGTTCATAAT 54
Quantitative real-time PCR (qPCR) primers
 VP0065 F ACCGGGTGTAAACAACCCAA 60
 VP0065R TACCGCCACAAGCTACAACC 60
 VP1708F CACGCCAGTAGAAGGTGACA 60
 VP1708R GTTGCCTAGGAACGCAGAAC 59
 VPA0083F GCAAGGCAGTGAAATTGGCA 60
 VPA0083R ACGTTACGCTGTTGGCAGTA 60
 VPA1708F CAGCCGCTGAAATCACCTTC 55
 VPA1708R TTTCTTGGCACGCTTTGACG 50
 16S F ACGGCCTGGGGAGTACGGTC 60
 16S R TTGCGCTCGTTGCGGGACTT 60
Complementation primers
 SGLTforward TCTAGAGGATGATCCCCGTAATTTCC 58
 SGLTreverse GAGCTCATTTGGCAGCAAGGTTGAATC 61
  1. aUnderlined base pairs indicate restriction sites