Skip to main content

Advertisement

Table 1 Metabarcoding primer sequences targeting the ITS region used in this study

From: Profiling grapevine trunk pathogens in planta: a case for community-targeted DNA metabarcoding

Primer name Direction Primer sequence 5′ to 3′ Citation
GTAA Forward AAAACTTTCAACAACGGATC this study
GTAA Reverse TYCCTACCTGATCCGAGGTC this study
BITS Forward CTACCTGCGGARGGATCA [48]
BITS Reverse GAGATCCRTTGYTRAAAGTT [48]
SP Forward CTTGGTCATTTAGAGGAAGTAA [49]
SP Reverse GCTGCGTTCTTCATCGATGC [49]