Skip to main content

Table 2 Characteristics of the best blocking oligonucleotides complementing the primer pair nu-SSU-1333-5′/nu-SSU-1647-3′ (FF390/FR-1)

From: A comprehensive fungi-specific 18S rRNA gene sequence primer toolkit suited for diverse research issues and sequencing platforms

Target Sequence ComPrim #nt Tm (°C) Fungi (%) Alv. (%) Rhiz. (%) Stram. (%) Tel. (%)
Alveolata gtcgctcctaccgattga nu-SSU-1647-3ˊ 16 50.3 0.08 52.6 6.3 0.9 3.3
Rhizaria ttaacgaacgagacctcga nu-SSU-1333-5ˊ 15 48.9 0 0 24.3 0.3 0
Stramenopiles tcgcacctaccgattgaa nu-SSU-1647-3ˊ 14 48.3 0 0.5 0.3 77.1 1.7
Telonema gaccttaacctactaaatagtta nu-SSU-1333-5ˊ 4 48.1 0 0.3 0 0 39.2
  1. Fungal and non-fungal eukaryotic sequence coverage rate tested by in silico analysis
  2. ComPrim Sequence complement to the indicated primer
  3. #nt Number of identical nt’s shared by primer and blocking oligo sequence
  4. Tm Annealing temperature
  5. %Fungi Coverage rate for fungal sequences
  6. %Alv. Coverage rate for Alveolata sequences
  7. %Rhiz. Coverage rate for Rhizaria sequences
  8. %Stram. Coverage rate for Stramenopiles sequences
  9. %Tel. Coverage rate for Telonema sequences
Back to article page

BMC Microbiology

ISSN: 1471-2180

Contact us