Advertisement
Table 2 Characteristics of the best blocking oligonucleotides complementing the primer pair nu-SSU-1333-5′/nu-SSU-1647-3′ (FF390/FR-1)
| Target | Sequence | ComPrim | #nt | Tm (°C) | Fungi (%) | Alv. (%) | Rhiz. (%) | Stram. (%) | Tel. (%) |
|---|---|---|---|---|---|---|---|---|---|
| Alveolata | gtcgctcctaccgattga | nu-SSU-1647-3ˊ | 16 | 50.3 | 0.08 | 52.6 | 6.3 | 0.9 | 3.3 |
| Rhizaria | ttaacgaacgagacctcga | nu-SSU-1333-5ˊ | 15 | 48.9 | 0 | 0 | 24.3 | 0.3 | 0 |
| Stramenopiles | tcgcacctaccgattgaa | nu-SSU-1647-3ˊ | 14 | 48.3 | 0 | 0.5 | 0.3 | 77.1 | 1.7 |
| Telonema | gaccttaacctactaaatagtta | nu-SSU-1333-5ˊ | 4 | 48.1 | 0 | 0.3 | 0 | 0 | 39.2 |
