Skip to main content

Table 1 Primer sequences

From: The culture of primary duck endothelial cells for the study of avian influenza

Host Name Sequence
Chicken vWF Forward: GCCAATGACTTCATG
Reverse: GCCACAGTCATTGGTG
Duck vWF Forward: ACCACATGTTAGTGAGGAAC
Reverse: CTTGGTAGGGTATGCTTCTC
  CD45 Forward: ATTGCCAGTATCTACCCTGC
   Reverse: TGTTGAGCTTTCTGTTCCCT