Skip to main content

Table 2 Oligonucleotides used in this worka

From: Architecture of divergent flagellar promoters controlled by CtrA in Rhodobacter sphaeroides

To obtain the strain AR1
 DinterB2for TCTAGATGGAACTCCTTTCAACGAC
 DinterI2rev TCTAGAACGGTCGTCGTCTACGA
To obtain pBAD_ctrA
 CtrABADFwSac GAGCTCATGAGAATACTGCTGGTGGA
 CtrABADRvEco GAATTCTCCAGCCCACCCTTCCCG
To clone the wild-type promoters
flgB2p (336 bp)
  FlgBI5 GAGTCTGATATCCGGGCGTGTCGGCATTG
  FlgBI2 GAATTCCACCCGGTCGCCCAGCGCGG
flgE2p (303 bp)
  pflgE2for GAATTCCGGTGCGAAACAACAGACT
  pflgE2rev GAGCTCATTGGCCGACTGCGTGAT
fliF2p (331 bp)
  FliFL5 GAGCTCAGACCGAGCACGGCCAGGAA
  FliFL2 GAATTCAGGCCCGACCAGGTGGCGTAG
fliI2p (product of 336 bp)
  FliBI3 GAATTCGATATCCGGGCGTGTCGGCATTG
  FliBI6 GAGCTCCACCCGGTCGCCCAGCGCGG
fliL2p (331 bp)
  FliFL3 GAATTCAGACCGAGCACGGCCAGGAAC
  FliFL6 GAGCTCAGGCCCGACCAGGTGGCGTAG
For the 5’ RACE experiments
 flgB2 RACE CGCACCATCTCATCCTCGAGCGAG
 N3’ flgB2 RACE GACCGTGTTGCCGTTGGGCGAAG
 flgE2 RACE GATATCCAGGGCGCTCGCGGTCGAGA
 N3’ flgE2 RACE CATTCCTCCACCCGCCGTATGGTGTT
 fliF2 RACE CACCTCGTAGGCCGCGCCCTGCGCC
 fliI2 RACE GGGCAGGATCGCCACCTCGTGCGACGAA
 N3’ fliI2 RACE GCCGCAGAACCTCGCCGCCGAGGATG
 fliL2 RACE CCAAGGCTGATCACGATCGGGTCGA
 N3’ fliL2 RACE CGATCGGCACGAAGGCGATGTCGGGA
For site directed mutagenesis
 flgB2p −10 GTTTCACCAAGGCGCAAGGGCGATTCCTTTAG
 flgB2p −13/−14 CACCAAGGCTTCGGGGCGATTC
 flgB2p −17/−18 CAAGGCTTAAGGCGGATTCCTTTAGAAAG
 flgB2p −23/−24 CTTAAGGGCGATTGGTTTAGAAAGGGTAAG
 flgB2p −27/−28 GGGCGATTCCTTCGGAAAGGGTAAGGCGC
 flgB2p −35 TAGAAAGGGTGGGGCGCGAAC
 flgB2p −42/−43 GAAAGGGTAAGGCGGCAACAAAGAGGGATTTG
 fliF2p −10 CCACATCCGTCCCGGATGGTCGGGC
 fliF2p −35 GATTGTTGGGCCACATCCGTCA
 fliI2p −10 TTGTTCGCGCCTCCCCCTTTCT
 fliI2p −26/−27 TTAAGGGCGAGGCCTTTAGAAAG
 fliI2p −35 CACCAAGGCTTCGGGGCGATTC
 fliI2p −47/−48 CTCCCTCGATCGGTGCCACCAAGGCTTAAGGGC
 fliL2p −10 GTCGATCTAGGGGCCGGATCCC
 fliL2p −35 GATTGTTGGGCCACATCCGTCA
  1. aThe undelines bases correspond to the changes introduced in the wild type sequence