Skip to main content

Advertisement

Table 1 Primer information and standard curves of microflora for Q-PCR

From: Differences in the digestive enzyme activity, intestinal mucosa and microbial community in loach cultivated in two separate environments

Bacterial species Primer sequence (5 → 3) Regression curve/Tm Reference
Total bacteria F: CGGYCCAGACTCCTACGGG y = 14.354–0.2607X [20]
R: TTACCGCGGCTGCTGGCAC R2 = 0.997 Tm = 59.5 °C
Firmicutes F: GGAGYATGTGGTTTAATTCGAAGCA y = 13.073–0.2985X [21]
R: AGCTGACGACAACCATGCAC R2 = 0.998 Tm = 60.5 °C
Bacteroidetes F: GGARCATGTGGTTTAATTCGATGAT y = 14.390–0.2807X [21]
R: AGCTGACGACAACCATGCAG R2 = 0.998 Tm = 58 °C
Bifidobacterium F: TCGCGTCYGGTGTGAAAG y = 13.837–0.2045X [21]
R: CCACATCCAGCRTCCAC R2 = 0.998 Tm = 61.5 °C
Enterococcus spp. F: CCCTTATTGTTAGTTGCCATCATT y = 14.356–0.2542X [21]
R: ACTCGTTGTACTTCCCATTGT R2 = 0.998 Tm = 52 °C
Lactobacillus spp. F: AGCAGTAGGGAATCTTCCA y = 14.899–0.2863X [22]
R: CACCGCTACACATGGAG R2 = 0.999 Tm = 58 °C
A. hydrophila F: GAAAGGTTGATGCCTAATACGTA y = 13.903–0.2050×  
R: CGTGCTGGCAACAAAGGACAG R2 = 0.991 Tm = 53.5 °C
Enterobacteriaceae F: CATTGACGTTACCCGCAGAAGAAGC y = 13.870–0.1927X [23]
R: CTCTACGAGACTCAAGCTTGC R2 = 0.995 Tm = 53 °C
Streptococcus spp. F: AGAGTTTGATCCTGGCTCAG y = 14.086–0.2630X [24]
R: GTTAGCCGTCCCTTTCTGG R2 = 0.996 Tm = 59.5 °C
  1. Note: “X” is representative the value of “Ct” of PCR, “C” representative the “Cycle”, “t” representative the “threshold”. And “y” is representative the Log10 DNA gene copies quantification data