Skip to main content

Advertisement

Table 2 Primers used in gene deletion experiments

From: Identification and analysis of genomic islands in Burkholderia cenocepacia AU 1054 with emphasis on pathogenicity islands

Primers Sequence (5’ to 3’)a
For mutagenesis of copR
LPW23977 (copR-UF) GCTCTAGACCGAAAGGGTTCATTACG
LPW23978 (copR-UR) TCAGCTTGACCTCGAGCCCCTTCTTCAG
LPW23979 (copR-DF) GGGGCTCGAGGTCAAGCTGATCCATACC
LPW23980 (copR-DR) ACATGCATGCTAGCCGTCGAGCAGATC
LPW24342 (copR-IF) GGTTTCAGCGTCGATCTC
LPW24485 (copR-IR2) CATGTCCCATACGTACGA
For mutagenesis of lipA
LPW23981 (lipA-UF) GCTCTAGAACATGCTCGAACGCTGTG
LPW23982 (lipA-UR) CAACGACTGCAATCAGCGCGTTCGATGG
LPW23983 (lipA-DF) CGCGCTGATTGCAGTCGTTGGTCAGTTG
LPW23984 (lipA-DR) CGAGCTCAGCACCTGCATGAACAC
LPW24340 (lipA-IF) GGCATACCCGTCTATGTG
LPW24341 (lipA-IR) GACGATGTTTGCCAACTG
For complementation of ∆copR and ∆lipA
LPW29008 (copR-CF) GGAATTCCATATGCGGCCATGCGCATCCTGATA
LPW29009 (copR-CR) TGCTCTAGACGTCATGCGTCGTCCTTCGG
LPW29010 (lipA-CF) GGGAATTCCATATGCATGAACGTATCGACACGCC
LPW29011 (lipA-CR) CTAGTCTAGATGTGCGGCTACGCCTGATCG
  1. aRestriction endonuclease sites in the primer sequences appear in bold