Skip to main content

Table 1 Sequences of PCR primers targeting various targeting various virulent factor genes in this study

From: Prevalence, virulence factor genes and antibiotic resistance of Bacillus cereus sensu lato isolated from dairy farms and traditional dairy products

Target gene Primer Primer sequence (5′ – 3′) Amplicon size (bp) Reference
nheA nheA 344 S TACGCTAAGGAGGGGCA 480 [11]
nheA 843 A GTTTTTATTGCTTCATCGGCT
nheB nheB 1500 S CTATCAGCACTTATGGCAG 754 [11]
nheB 2269 A ACTCCTAGCGGTGTTCC
nheC nheC 2820 S CGGTAGTGATTGCTGGG 564 [11]
nheC 3401 A CAGCATTCGTACTTGCCAA
hblA HBLA1 GTGCAGATGTTGATGCCGAT 301 [11]
HBLA2 ATGCCACTGCGTGGACATAT
hblC L2A AATGGTCATCGGAACTCTAT 731 [11]
L2B CTCGCTGTTCTGCTGTTAAT
hblD L1A AATCAAGAGCTGTCACGAAT 411 [11]
L1B CACCAATTGACCATGCTAAT
cytK CK-F-1859 ACAGATATCGG(GT)CAAAATGC 809 [46]
CK-R-2668 TCCAACCCAGTT(AT)(GC)CAGTTC
entFM ENTA ATGAAAAAAGTAATTTGCAGG 1, 269 [63]
ENTB TTAGTATGCTTTTGTGTAACC
Ces cesF1 GGTGACACATTATCATATAAGGTG 1, 271 [16]
cesR2 GTAAGCGAACCTGTCTGTAACAACA