Skip to main content

Table 2 Distribution of controller protein (HsdC) homologs and their predicted binding sites in Mollicutes. HsdC binding sites are underlined

From: Binding site of restriction-modification system controller protein in Mollicutes

Species RM-system Sequence
A. equifetale Type I CAATTTAACGATTTGCTACTTTTGAACGATTATTCAACAAATGAACGATTAGGGG
A. hippikon Type I TATTTAACGATTACCATACTTTTTAACGATTTGACAACAATTTAACGATTTGAGA
A. granularum Type I TTTTATTTTGTTAGTCAACTATTTAACGATTACCTTACTTTTTAACGATTTGAGA
A. modicum Type I TTTGAACGTTTAGGGCTAGTTTTGAACGATTACTCAACTTTTGAACGATTTGAGA
M. arginini Type I ATAGCAGAAAGTGCTATAATAGTGTATAATATAATCA
M. conjunctivae Type I CTCAAGTTTTTTGTTATAATTAAACAAGATAAAAAGC
M. fermentans Type I AAAAAATAAAATGTTATAATTTGTTATAAGTTGTTAG
M. gallinarum Type I CGACTAAAAAGTGCTAAAAATGTGATATAATTGTGGC
M. gallisepticum Type I TATCGGCTTTGTGTTAAAATAGTGTTAACGATTTTGA
M. callifornicum Type II fusiona TGTCAAGTAGAGGACATAAAGTCCTTATATCAGCT
M. hominis Type II AATCGACAAAGTGATAGTTTTGTGATATAGTTAAGAT
M. hyosynoviae Type II TATAGAGTAAATGTAATAAAAATGATATAATTTTGTC
M. mobile Type II fusiona TTGTATATTTTAACACACAAATGTTATAATGTAATT
M. simbae Type II fusiona TGTTAATAAGCGGACAAATAGTCCTAAATTAATAA
U. canigenitalium Type II fusiona TAGTTATAATATGTCATATTAGTGTCATATATGAATT
  1. Controller-protein binding repeats are underlined
  2. A. – Acholeplasma, M. – Mycoplasma, U. – Ureaplasma
  3. afusion of controller protein with methylase of RM-system