Skip to main content

Table 1 Oligonucleotides used for EMSA experiments (only plus strand is shown)

From: Binding site of restriction-modification system controller protein in Mollicutes

Oligonucleotide Sequence
P hsdC -WT TTATCGGCTTTGTGTTAAAATAGTGTTAACGATTTTGAAG
P hsdC -mut1 TTATCGGCTTTCTGTTAAAATACTGTTAACGATTTTGAAG
P hsdC -mut2 TTATCGGCTTTGTCTTAAAATAGTCTTAACGATTTTGAAG
P hsdC -mut3 TTATCGGCTTTGTGTACAAATAGTGTACACGATTTTGAAG
P hsdC -mut4 TTATCGGCTTTGAGTTAAAATAGAGTTAACGATTTTGAAG
P hsdC -mut5 TTATCGGCTTTGTGATAAAATAGTGATAACGATTTTGAAG
P hsdC -mut6 TTATCGGCTTTACCTATAAATAGTGTTAACGATTTTGAAG
P hsdC -mut7 TTATCGGCTTTGACTTAAAATAGTGTTAACGATTTTGAAG
P hsdC -mut8 TTATCGGCTTTGAGTTAAAATAGTGTTAACGATTTTGAAG
P hsdC -mut9 TTATCGGCTTTGTCTTAAAATAGTGTTAACGATTTTGAAG
Neg AAAACACCCTATTTTTGATATGATATAGTCATACAAAGGA
P mraZ AATTCAAAAGTGTTAAAAAGTGTGAGAAAGTGGGAAAAAT
P clpB TAATAGCCTAAGTGCTAATTTTTTGTTATAATAAATCTAT
P trnM ATTGTTATTATATGATAATAATGTGTAACACATCGCGGGA