Skip to main content

Table 1 Primer sequences

From: Pyruvate oxidase of Streptococcus pneumoniae contributes to pneumolysin release

Primer name Sequence (5′-3′)
LytA-KO1 GCGGGTACCCAGTCCAGCTTTGGTTTCCT
LytASup TAAAAATATCTCTTGCCAGTCCTTGCCTATATGGTTGCACG
LytASdn GGTAATCAGATTTTAGAAAACAATAAACCCTCACAGTAGAGCCAGAT
LytA-KO4 CGCGGATCCTCACAGTAGAGCCAGATGGC
PlyAF CTCAATCCAGCTACCTGTCGC
PlyAR GTTTGCTTCTAAGTCTTATTTCCCTTCTACCTCCTAATAAG
PlyBF GAGTCGCTTTTGTAAATTTGGGAGAGGAGAATGCTTGCG
PlyBR GCTTGTTTAGCACGGTCG
ALR1 GCG GGTACCGCGTGCTATTGCAGATCAAA
ALR2 GCGTCTAGACATCGTTAATCGGAGATGGA
ALR3 CGCGGATCCATCTACGCCCCATGTTTTCAATACG
ALR4 CGCGGATCCACCATTCCGTCTCTTCTTGG
ALR5 CGCGGATCCGGAAATAAGACTTAGAAGCAAAC
ALR6 CGCGGATCCCCAAATTTACAAAAGCGACTC
SpxB-F CGCGCCCGGGTGACAACACTTTCAAAACTG
SpxB-R CGCGGAATTCTTATTTAATTGCGCGTGATTGC
ERM-F GGAAATAAGACTTAGAAGCAAAC
ERM-R CCAAATTTACAAAAGCGACTC
Spec-F CGTGACTGGCAAGAGATATTTTTA
Spec-R GGGTTTATTGTTTTCTAAAATCTGATTACC
PLY-F CAGAGCGTCCTTTGGTCTATATT
PLY-R CAGCCTCTACTTCATCACTCTTAC