Skip to main content

Table 1 Oligonucleotide primer for 16S rRNA gene amplification and sequencing

From: Diversity of Clostridium perfringens toxin-genotypes from dairy farms

Primer Sequence (5′–3′) Locationc
16S rRNA gene amplification primera
 16SUNI-L AGAGTTTGATCATGGCTCAG 8-27
 16SUNI-R GTGTGACGGGCGGTGTGTAC 1410-1391
16S rRNA gene sequencing primerb
 533F GTGCCAGCAGCCGCGGTAA 514-532
 907R CCGTCAATTCMTTTGAGTTT 925-906
  1. aKuhnert P, Capaul SE, Nicolet J, Frey J. Phylogenetic positions of Clostridium chauvoei and Clostridium septicum based on 16S rRNA gene sequences. Int J Syst Bacteriol. 1996;46:1174-1176
  2. bPetti CA. Detection and identification of microorganisms by gene amplification and sequencing. Clin Infect Dis. 2007;44:1108–1114
  3. cIndicating the position of each primer relative to the 16S rRNA gene sequence of E. coli J01859
\