Skip to main content

Table 2 Sequences of the primer pairs used in this study for q-PCR

From: Quantitative proteomic analysis of cell envelope preparations under iron starvation stress in Aeromonas hydrophila

Name Description Primer Sequence (5′➔3′) Nucleotide position Product size (bp) Reference
A0KNY2 Outer membrane efflux protein F AGTTCGGTCAAGATGCTGTGG 193 193 This study
   R CGATCTCCTGCTTGGTCTGC 385   This study
A0KQX7 ATP synthase epsilon chain F CTCCGTTGCTGACTGCCATC 116 166 This study
   R GCTTTCGCCTCATCCAAATCG 281   This study
R4VLV7 ATP synthase gamma chain F AGGCTTACGACAACGGTGAG 473 199 This study
   R TAGCGAATCAGCAGGGTATCC 671   This study
R4VV29 ATP synthase subunit alpha F CAACGCCGAGTATGTAGAGAAG 912 164 This study
   R GCTGTGAGGTCAGGAAGATC 1,075   This study
R4W2U5 ATP synthase subunit b F ATTGCTGACGGTCTCTCTTCC 55 150 This study
   R CTCATCAATGATCTGGGCTTTACG 204   This study
A0KJN3 Ferrichrome-iron receptor F GCTTCGGTCTTCCACATCAC 1,606 176 This study
   R ATCTCCATATCCTGACGGGTATAG 1,781   This study
R4W0J5 Ferrichrome receptor F GGCAAGAACGAGAAGCAGTATG 1,216 150 This study
   R CTTGTAGGATTGGCTGGTGTTG 1,365   This study
A0KHF6 Maltoporin F CCTTCGCCGTTGATTTCCAC 125 165 This study
   R TCTTGCCGTCCTTGTTGAATAC 289   This study
R4VCH3 Outer membrane porin protein F TACAACCAGAACGACACCAAAC 73 165 This study
   R GTATTCAGCGAAGCCGAACG 237   This study
R4VG84 Peptide ABC transporter periplasmic peptide-binding protein F GACAACAAGACGGTGCTGAC 52 165 This study
   R CAGACGATAGACGGGTTTGC 216   This study
R4VJ80 ATP synthase subunit beta F GGGTCTGGTGCTGGAAGTTC 117 123 This study
   R ACCTGGATGGATTTACCGCTATTC 239   This study
R4V7Y6 Cytochrome c4 F TCTGAACAGGACATGGAAGACC 268 198 This study
   R GGACAGGCTCGGATACTTGG 465   This study
R4VH33 Cytochrome c551 peroxidase F ACTCCAGCCTCAACTTCGTG 269 181 This study
   R AAGTCCGCCTTGCCATACAC 449   This study
A0KJP9 TonB-dependent siderophore receptor F AGACCGATCTGATGGATGACTC 944 168 This study
   R CATTGGTGATGCTGCGACTG 1,111   This study
A0KL28 Cytochrome c-type protein NrfB F GATGCCGCCTGTACCGACTG 160 192 This study
   R GGTGCTCTGTTTGTCCTTGAAG 351   This study
R4VF53 Cytochrome c553 F GCCTTAGCGACGAGCAGATC 95 148 This study
   R CCTTCGGAGTGGCACTTCTTG 242   This study
R4VNL8 Cytochrome c552 F GAGCAGGGCAAGGTCTACAC 886 144 This study
   R CTTGAGATCGTGAATGGCATCC 1,029   This study
A0KQV7 Cytochrome c5 F AAGGATCTGGAAGGGATTGCG 103 112 This study
   R CATCGTGGCAGGCGAAGCAG 214   This study
R4VS58 Fumarate reductase flavoprotein subunit F TGAACTTCCTCAAGCACACTCTC 1,615 150 This study
   R AGCCATTCTTCTTAGCCTCGTC 1,764   This study
R4VNP5 Fumarate hydratase F ACCTGCTTCGTCAAGATCGG 217 169 This study
   R GGGCATTGTCCTTGGTGTTC 385   This study
K1JGN0 Pyruvate-flavodoxin oxidoreductase F GCTCAGGGCTACTTCGTCTAC 1,360 162 This study
   R CTCCAGCAAGTCTACCGATTCG 1,521   This study
GAP-1 Glyceraldehyde 3-phosphate dehydrogenase F AGAGCCTCAATGCCTATCTGC 1,102 195 [53]
   R ACCCGAACTCGTTGTCATACC 1,306   [53]