Skip to main content

Table 3 Lists of primers used in this study

From: The GAS PefCD exporter is a MDR system that confers resistance to heme and structurally diverse compounds

Primers name (Target) Restriction site (Use) Sequence (5’–3’) Source
ZE565 (pefC) EcoR1 GGGGAATTCTTATGGTGGGTCATTGTTG This study
ZE566 (pefC) EcoR1 AATGAATTCTAAGCGAGGGATGAGCTGTG This study
ZE634 (pefRCD) SpeI AAGGACTAGTGGTCTTGGCTAATAAGGCG This study
ZE635 (pefRCD) SpeI AGGGACTAGTTTGGGATTCATGTTAGCGAG This study
ZE553 (pefR) NA TGAGGAGACAACGATGCTTAAAGAC This study
ZE554 (pefC) ClaI AAAAAATCGATCAGGGTTGTTTGACTTAG This study
ZE458 (pefR) NA CACAAGTGATAGGTGATTTACGTG This study
ZE562 (pefR) NA CCTTGAGGACCTGCTAGATGCTCTAC This study
ZE649 (pefD) NA GGAGAATTGCAGCTGGCC This study
ZE650 (pefD) NA AGCTGGTGAACGCTGGTGC This study
ZE653 (pefC) NA GCGTTCAAGAAGGCCTTAAGTC This study
ZE654 (pefC) NA CCACCAACTCTGCGTGTGTTC This study
ZE581 (rpsL) NA CAGATTCACCAGCTTTGAAC [15]
ZE582 (rpsL) NA CAACACGAGTAGCAACG [15]
SpecFw NA GTGAGGAGGATATATTTGAATACATACGAA This study
SpecRev NA GTCCATTCAATATTCTCTCCAAGATAACTA This study