Skip to main content

Table 5 Oligonucleotide primers used in this study

From: DNA repair genes RAD52 and SRS2, a cell wall synthesis regulator gene SMI1, and the membrane sterol synthesis scaffold gene ERG28 are important in efficient Agrobacterium-mediated yeast transformation with chromosomal T-DNA

Primer Resultant construct Sequence (5′-3′)
BamINLB pBYM3, pBYM4 and pBINU1 CGGGATCCTCAATTTGTTTACACCAC
BamINRB pBYM3, pBYM4 and pBINU1 CGGGATCCCAGTTTAAACTATCAGTG
SRS2Fw pSRS2 GGAATTCCAGGAGTGAAGACATCTGC
SRS2Rv pSRS2 GGAATTCCGACTTGGGACTATTGGAC
RAD52Fw pRAD52 GGAATTCTAACGGTGAGTGTGGCAACG
RAD52Rv pRAD52 GGAATTCTGAACCTAAGGATTCCGCTG
SMI1Fw pSMI1 GGAATTCCACTGATCCATTTACCTGC
SMI1Rv pSMI1 GGAATTCCTCATGCTCTTCAATGTCG
ERG28_2_Fw pERG28 CGAGGAATTCTCGGGGACAACAACTTCAG
ERG28Rv pERG28 GGAATTCTGAGCTGGAGCAGACATTG
URA3-BamHIfw pBINU1and pBINU2 CGGGATCCCGAGTCGCATAAGGGAGAGC
URA3-BamHIrv pBINU1 CGGGATCCCGATCAGCGTGGTCGTGAAG
URA3-EcoRI pBINU2 CGGAATTCCTGAAGCTCTAATTTGTG
URA3-probe-Fw URA3 probe CTTAACCCAACTGCACAGAACA
URA3-probe-Rv URA3 probe GCAATAAAGCCGATAACA
Amp-probe-Fw Amp r gene probe TGCAATGATACCGCGAGAC
Amp-probe-Rv Amp r gene probe CGAACTGGATCTCAACAGCGGTAA
pBY1-RB-Seq for sequencing GAACGCGCAATAATGGTTTCTG
pBY1-RB-Seq2 for sequencing GGGCGCACCGCAGATGGAAA