Skip to main content

Table 6 Oligonucleotide primers and PCR conditions used for genotyping of Helicobacter pylori strains isolated from Iranian bottled mineral water

From: Helicobacter pylori in bottled mineral water: genotyping and antimicrobial resistance properties

Genes Primer Sequence (5’-3’) Size of product (bp) Volume of PCR reaction (50 μl) PCR programs
vacA s 1 a F: CTCTCGCTTTAGTAGGAGC 213 5 μL PCR buffer 10X 1 cycle: 95 °C ------------ 1 min.
R: CTGCTTGAATGCGCCAAAC
vacA s 1 b F: AGCGCCATACCGCAAGAG 187 1.5 mM Mgcl2 32 cycle: 95 °C ------------ 45 s
CTGCTTGAATGCGCCAAAC 200 μM dNTP (Fermentas)
vacA s 1 c F: CTCTCGCTTTAGTGGGGYT 213 64 °C ------------ 50 s
R: CTGCTTGAATGCGCCAAAC 0.5 μM of each primers F & R
vacA s 2 F: GCTAACACGCCAAATGATCC 199 72 °C ------------ 70 s
R: CTGCTTGAATGCGCCAAAC 1.25 U Taq DNA polymerase (Fermentas)
vacA m 1 A F: GGTCAAAATGCGGTCATGG 290 1 cycle: 72 °C ------------ 5 min
R: CCATTGGTACCTGTAGAAAC
vacA m 1 B F: GGCCCCAATGCAGTCATGGA 291 2.5 μL DNA template
R: GCTGTTAGTGCCTAAAGAAGCAT
vacA m 2 F: GGAGCCCCAGGAAACATTG 352
R: CATAACTAGCGCCTTGCA
cag A F: GATAACAGCCAAGCTTTTGAGG 300 5 μL PCR buffer 10X 1 cycle: 94 °C ------------ 1 min.
R: CTGCAAAAGATTGTTTGGCAGA
2 mM Mgcl2 32 cycle: 95 °C ------------ 60 s
150 μM dNTP (Fermentas)
0.75 μM of each primers F & R 56 °C ------------ 60 s
1.5 U Taq DNA polymerase (Fermentas) 72 °C ------------ 60 s
1 cycle: 72 °C ------------ 10 min
3 μL DNA template
iceA 1 F: GTGTTTTTAACCAAAGTATC 247 5 μL PCR buffer 10X 1 cycle: 94 °C ------------ 1 min.
R: CTATAGCCASTYTCTTTGCA
iceA 2 F: GTTGGGTATATCACAATTTAT 229/334 2 mM Mgcl2 32 cycle: 94 °C ------------ 60 s
R: TTRCCCTATTTTCTAGTAGGT 200 μM dNTP (Fermentas)
56 °C ------------ 60 s
0.5 μM of each primers F & R
72 °C ------------ 60 s
1.5 U Taq DNA polymerase (Fermentas)
1 cycle: 72 °C ------------ 8 min
5 μL DNA template
oip A F: GTTTTTGATGCATGGGATTT 401 5 μL PCR buffer 10X 1 cycle: 94 °C ------------ 2 min.
R: GTGCATCTCTTATGGCTTT
2.5 mM Mgcl2 32 cycle: 94 °C ------------ 60 s
200 μM dNTP (Fermentas)
56 °C ------------ 60 s
0.5 μM of each primers F & R
72 °C ------------ 60 s
2 U Taq DNA polymerase (Fermentas)
1 cycle: 72 °C ------------ 10 min
3 μL DNA template
cagE F: TTGAAAACTTCAAGGATAGGATAGAGC R: GCCTAGCGTAATATCACCATTACCC 508 5 μL PCR buffer 10X 1 cycle: 94 °C ------------ 1 min.
2 mM Mgcl2 35 cycle: 94 °C ------------ 60 s
150 μM dNTP (Fermentas)
53 °C ------------ 45 s
0.75 μM of each primers F & R
72 °C ------------ 45 min
1.5 U Taq DNA polymerase (Fermentas)
1 cycle: 72 °C ------------ 8 min
3 μL DNA template
BabA2 F: CCAAACGAAACAAAAAGCGT 271 5 μL PCR buffer 10X 1 cycle: 95 °C ------------ 1 min.
R: GCTTGTGTAAAAGCCGTCGT
1.5 mM Mgcl2 30 cycle: 91 °C ------------ 60 s
200 μM dNTP (Fermentas)
45 °C ------------ 60 s
0.5 μM of each primers F & R
72 °C ------------ 60 s
1.25 U Taq DNA polymerase (Fermentas)
1 cycle: 72 °C ------------ 8 min
2.5 μL DNA template