Skip to main content

Table 1 C. perfringens targeted primers used in this study

From: Sensitive quantification of Clostridium perfringens in human feces by quantitative real-time PCR targeting alpha-toxin and enterotoxin genes

Target Standard strain Primer Sequence (5' - 3') Product size (bp) Annealing temp (°C) Reference
plc gene C. perfringens ATCC 13124T Cper-plc508-F CCGTTGATAGCGCAGGACA    
   Cper-plc508-R CCCAACTATGACTCATGCTAGCA 219 60 This study
cpe gene C. perfringens GAP11 GGTTCATTAATTGAAACTGGTG 154 55 [37]
   GAP12 AACGCCAATCATATAAATTACAGC    
16S rRNA gene C. perfringens ATCC 13124T s-Clper-F GGGGGTTTCAACACCTCC 170 60 [38, 74]
ClPER-R GCAAGGGATGTCAAGTGT