Skip to main content

Advertisement

Table 3 Primer pairs for each target gene for quantitative real-time PCR

From: Deep sequencing analysis of transcriptomes in Aspergillus flavus in response to resveratrol

Gene Name Primer sequence (5′-3′) Product size Annealing temperature (°C)
(bp)
Up-regulated    
 AFLA_125090 AGGTTGTTCTCGGTCTGGTT 137 65
GCAAGGTCACCTACATGCAC
 AFLA_075280 AGCTGGTTCGGTTTACCATC 128 64.5
ATGGCGATAGGGACAGGTAG
 AFLA_057960 TGCAGACCAATGTTCATCCT 108 64.5
GTTGTCTCAGTCGTGCCAGT
 AFLA_039390 CGCAACAAAGCAAGACATTT 128 61.4
GTCGGAGGGCTTGATTGTAT
 AFLA_077590 CGTCGATTATGATGGAGACG 65 58.9
CACTGCTCAGCATTCCGTAT
 AFLA_021650 GTTGGGCTATACGGAGGTGT 137 58.9
GCCATAGAGCAGCCAGTACA
 AFLA_075300 GTGATTCATAGGGCCGACTT 156 64.5
GACGACAAGGTCTCCGGTAT
 AFLA_023780 CTCCTCGACCGATTACCATT 125 57.1
CCCACTAACCACATCGACAG
Down-regulated    
 AFLA_117290 TTGCCCTCTGTTGAAGACTG 92 65
CCTCGTAGGACTTCCTCAGC
 AFLA_112010 CAGTCGAACCCTATCCACCT 145 58.9
TACGTTCGGAGACACGGATA
 AFLA_137320 AGCTACCCAGCACCAGAAGT 76 58.9
TGTAGGCAGGAGTCTGTTCG
 AFLA_117420 CGGCAGAAGAGTACTGGTGA 106 57.1
ACGACTGGTGGTGACGATAA
 AFLA_117340 TACAACCGGCTACAGCTCAC 113 57.1
TGATCGACTCGGAAAGACTG
 AFLA_058990 ACGAGTCCTACCACCAGTCC 64 55
TTGATGGTTCCTCCTCCTTC
 AFLA_128370 CCCTCTTTGGTAAGAATCGC 144 55.8
CGTCGGCCATATTCACATAG
 AFLA_129450 GTACAGCCGTGGGATTCTTT 112 55.8
TGGAGCCAGTAGATATTGCG