Skip to main content

Advertisement

Table 1 Primers, probes and cycling parameters

From: Detection of Anaplasma phagocytophilum in Ixodes ricinus ticks from Norway using a realtime PCR assay targeting the Anaplasma citrate synthase gene gltA

Name Sequence Function Tm Concentration
ApF TTTTGGGCGCTGAATACGAT Forward Primer 59 °C 300 nM
ApR TCTCGAGGGAATGATCTAATAACGT Reverse Primer 58 °C 300 nM
ApM TGCCTGAAC AAGTTATG 5’ hydrolysis probe 69 °C 300 nM
  1. Cycling parameters: 50 °C, 10 min; 95 °C, 2 min; {95 °C, 15 s; 60 °C, 60s} × 40 cycles
  2. The initial 50 °C incubation is an optional step allowing the decontaminating action of uracyl nucleoside glycosylase (UNG), if present