Skip to main content

Table 2 Primers used in this study

From: Overexpression of Enterococcus faecalis elr operon protects from phagocytosis

Name Sequence 5'-3' Source or Reference
OEF9 TTGACCATCACGAGATACC This work
OEF13 CTATCTTGGTCAAAAGAGCG This work
OEF15 TATTCGATGTTGGCGTTGG [4]
OEF18 GGAGGATGCGATTGTTTCG [4]
OEF212 CTCTTCTGCCGATGAAGTTTCTGG [4]
OEF275 CAAACATGTTAGAAACGACCGAAACAATCGC This work
OEF276 TTGGATCCACTCACCCCCTATTTTGC This work
OEF343 GCGAATTCGAAGATCTGAGAAAATATCAGGAGGTGAAG This work
OEF344 ATGGATCCAGACGGAGTAGGTTATTTGC This work
OEF345 TTCTCAGATCTTCGAATTCGCTGAATATCAACTGAAAATGGG This work
OEF346 ATCTCGAGTTGCGTATTTCGGATTTAGCC This work
OEF49 CACGCTGTACGATCAGCAAC This work
OEF595 CAATCCTAATAGCAATACACC This work
OEF596 GGTGTATTGCTATTAGGATTGTGCCTGTTCATCATTTTACG This work
OEF598 CGAAACAATCGCATCCTCCTGCCTGTTCATCATTTTACG This work
Vlac1 GTTGAATAACACTTATTCCTATC [16]
Vlac2 CTTCCACAGTAGTTCACCACC [16]