Skip to main content

Advertisement

Table 2 PCR conditions for the detection of the genes specific to the strains used in the in vivo chicken colonization competition assay

From: Extensive characterization of Campylobacter jejuni chicken isolates to uncover genes involved in the ability to compete for gut colonization

Gene Primers (5′–3′) Cycle
pseD F: GATGGAATGGTAAGCGTTGCACA 95°C for 20 s
  R: TTATCCTTGCTCCACCTTCGGTGC 56°C for 20 s
   72°C for 20 s
virB11 F: TCTTGTGAGTTGCCTTACCCCTTTT 95°C for 20 s
  R: CCTGCGTGTCCTGTGTTATTTACCC 65°C for 20 s
   72°C for 20 s
CJ0144 F: TTCATGAAGTTGTGAATGCTGAAA 95°C for 20 s
  R: TCGCTTACAACAAGTTCGCC 61°C for 20 s
   72°C for 10 s
  1. All PCR cycles were preceded by an initial denaturation step consisting of a 15-min incubation at 95°C; All PCR runs were ended by a final 5-min elongation step at 72°C followed by a denaturation curve analysis.