Skip to main content

Table 2 Primers used in this study

From: Transient transformation of Podosphaera xanthii by electroporation of conidia

Target gene Primer name Sequence (5′- 3′) Product size (bp)
TUB2 Btale-F GGGCCCGCCTCAGCCTATGCCATTCG 4000
  Btale-R GGGCCCAGTCAAGACCCGGAGCA
hph hph-F GACATCACCATGCCTGAACT 1700
  hph-R GGTAACGCCAGGGTTTTCCC
egfp GFP-F CTGAAGTTCATCTGCACCACC 600
  GFP-R CTTTACTTGTACAGCTCGTCC