Skip to main content

Advertisement

Table 1 List of primers for real-time PCR

From: Cecropin P1 inhibits porcine reproductive and respiratory syndrome virus by blocking attachment

Primer # Sequences (5′-3′)
ORF7(N)-F AAAACCAGTCCAGAGGCAAG
ORF7(N)-R CGGATCAGACGCACAGTATG
mGAPDH-F TGACAACAGCCTCAAGATCG
mGAPDH-R GTCTTCTGGGTGGCAGT GAT
mCaspase-3-F ATGTCCGGGATCTGGGTTCT
mCaspase-3-R CTAGGTCAAGCTTTCATTCT
pHPRT1-F TGGAAAGAATGTCTTGATTGTTGAAG
pHPRT1-R ATCTTTGGATTATGCTGCTTGACC
pIL-6-F AATGTCGAGGCTGTGCAGATT
pIL-6-R TGGTGGCTTTGTCTGGATTCT
pTGF-β1-F AGGGCTACCATGCCAATTTCT
pTGF-β1-R CCGGGTTGTGCTGGTTGT
pIFN-β-F TCCAGCTCTTCAGCACAGAG
pIFN-β-R AGCTGCTGATCCAGTCCAGT
pIFN-β-F GGAGACAATCCTGGAGGAAAT
pIFN-β-R TTCAGGTGAAGAATGGTCATGT
  1. #F: forward primer, R: reverse primer. The “m” prior to a primer name indicates it is for a monkey gene, and the “p” prior to a primer name indicates it is for a porcine gene.