Skip to main content

Table 4 Primers used in this study

From: Clostridium difficilehas a single sortase, SrtB, that can be inhibited by small-molecule inhibitors

Primer Sequence
pET_3 gatattccatggatgaagaaactgtaccgtatcgttatc
pET_4 gatgagctcgaggatcagacgaccgtggataacc
pET_17 gatataccatggatgcaccaccaccaccaccactctaaactgaccaaatacaaccacgacac
pET_16 gatgagctcgagttagatcagacgaccgtggataac
C209A tcgttaccctgtctaccgccacctacgaattcgacg
C209A_antisense cgtcgaattcgtaggtggcggtagacagggtaacga
T7F taatacgactcactataggg
T7R gctagttattgctcagcgg