Skip to main content

Table 5 Primers used for the screening of pRS218 genes among neonatal meningitis causing E. coli and fecal commensal E. coli strains

From: Complete nucleotide sequence of pRS218, a large virulence plasmid, that augments pathogenic potential of meningitis-associated Escherichia coli strain RS218

Coordinates in pRS218 Gene name Predicted function Primer F (5′-3′) Primer R (5′-3′) Product size (bp)
4107- 4265 pRS218_007 Copper sensitivity gagacgttgagcaccaatctg accgccagtttttctttcac 140
4255- 4761 pRS218_008 Copper sensitivity catacgctggacggggaaac gacgctctccccttccgact 143
4998- 5759 pRS218_010 Na + traslocation atcaatgatggtgctttgtgtc ccggtaactggaatgataacct 378
6052-7992 pRS218_013 Iron permease gtgttcgagaacctggaagg cggttttgtctgagggacat 401
8033- 8560 pRS218_014 Iron transport ctgtcaccatgaatgaaatgga ctcacatcaaacggtttccac 400
8664- 10043 pRS218_015 Membrane protein tcgtgacggtaaactgcatc gccgccatagctgtatttgt 400
10046- 11329 pRS218_016 ABC transporter aaggggtggtgatcgataaaat catacagcacctccacaggata 399
11319- 12449 pRS218_017 Membrane protein aggtcaccggtagctggatt atcgagaccagtcccatcag 400
12454- 13149 pRS218_018 ABC transporter gttccatttgatcccgttctta acccagatatttaccgtgttgc 379
13136- 13621 pRS218_019 Putative thioredoxin precursor gcgggtgtaaagaagaaaagc agacggcttacgcataccc 401
13646- 14131 pRS218_020 Hypothetical protein atagcgcaactgcttcacacta acgttccgtatcgacaaattct 303
14253- 14702 pRS218_022 Glucose-1-phosphatase agacaacgccggaaggttat tttcctgatgatgtaccggaat 354
14677- 14997 pRS218_023 Glucose-1-phosphatase acgatggacccaacgtttaat ataggctgattcgatgtgtttg 311
18173- 17826 pRS218_031 Hypothetical protein attgccctgatggacagc gtggcagccggttaacttt 301
20251-20775 pRS218_034 Colicin immunity ttaataatatgtggtggggatgg atgaaaacagtacccgtataaacagc 250
21065-21982 pRS218_035 ColicinJ production tggcttattcaaaatttgctcat tgcatagatatgatggtttcacg 350
21990-22766 pRS218_036 ColicinJ production ctgattttccttgcgtttatctg agcctttatcttacgaggtggac 294
22935- 25196 pRS218_038 ColicinJ production tatgatgcaggttttgcttttg tggcatcatgttgagcttattc 393
25265- 26440 pRS218_039 Enterotoxin gcagattcgcgttttgagca cggatctttcaacgggatgg 302
28517- 27762 pRS218_042 Hypothetical protein tgacgctatgcaatgaagaact tgacatagccaagatcatccac 399
38291- 37500 pRS218_056 Hypothetical protein cgtccacggattatgtctataaaac gtatgacgggatgatttcagataac 373
40184- 38298 pRS218_057 ColicinJ production ctgtggataacagcctcatcaa atgttaaccgggtagcttttca 301
43799-42630 pRS218_060 Hypothetical protein ctcttccccatggcctttat accccatactgcattggaaa 600
46748- 46975 pRS218_063 Hypothetical protein tggatcctttgttgatcattcat cctgtaaagacagacttcagaaaaa 224
48251- 47610 pRS218_064 Hypothetical protein tcgacctaacccttgatcagtt tatagcgacaggatggacagtg 385
52321- 52046 pRS218_073 Hypothetical protein cagccagcaagcattaaaca gctcaagggctactctgacg 276
53188- 54159 pRS218_074 Stability protein StbA ttgtcgcaaaactcatttcg cgaccagacgagaaaacaca 400
56513- 56265 pRS218_079 Hypothetical protein cgcattgaaattcttttcgac tcgtcctgccagatttcttc 249
56648- 57166 pRS218_080 Unknown gtgttcgtgatctcgtttcgta ttgcccactttcttaatcttcc 351
58824- 59654 pRS218_082 Hypothetical protein acaaatgaaggtattcagctgtttc cgacagtacgttgtcacacagac 372
60445-59648 pRS218_083 Transposase gcttcgggaacgctgtaacg agaaggctgcggtgctgaag 414
61858- 62169 pRS218_086 Hypothetical protein ttttccggtaaaggatgtcg gtctttctgacggcaaggctat 223
62245- 62928 pRS218_088 Adenine-specific methyltransferase cggtgatgttaatgatgactgg gtgtgaagctctcaatcagtgg 356
62929- 63150 pRS218_089 Cytoplasmic protein ctatgccggacacgaaaaac gaagcaggaatccagttcca 208
63230- 63598 pRS218_090 Hypothetical protein gttatctggtccccggaaga cattcacgtttccacaatgc 254
63643- 64614 pRS218_091 Hypothetical protein atgaatgaaatgctgaatgcac catcttctgccacctggtaact 406
63643-64614 pRS218_091 Hypothetical protein cgcctggtggtgaaggaaag gaccacctcccgcagaacac 236
64828- 65253 pRS218_092 Putative antirestriction protein gttgaagagtgcgaccgtct agtcaagtgccgcgtaaatc 400
65300- 65722 pRS218_093 Phage protein MubC catccgcgatgtactggatac ctgtaacacaacgtccattgct 373
65719- 65910 pRS218_094 Hypothetical protein cacagaaacccgcgaaat ctgtttctgctgccctgtaag 177
66381- 65887 pRS218_095 Hypothetical protein cttacatcccggcgtcgt cctgatgttatgtttctgtggttact 256
67155- 68516 pRS218_099 Hypothetical protein tatggcaaaactcatcagcagt gtaatttggcgttgtgactgaa 385
68563- 69126 pRS218_100 Hypothetical protein tctcagctttttgtgagtcctg aaaacggtaacagcttctcctg 400
70556- 70789 pRS218_105 Cytoplasmic protein gcgaatatttcagaatacttcagg aattccggatgacatggttc 213
70848- 72806 pRS218_106 Hypothetical protein agtgtgaggaatctgacctgct taatgtttacattccaggctgattt 400
72861- 73271 pRS218_107 Adenine-specific methyltransferase ataccatgaacgcacaggaata ggatgatgtcgttaacgctgta 371
74286- 74444 pRS218_109 Hok/Gef cell toxic protein atgaaactaccacgcagctctc taccggattcgtaagccatga 154
75004- 74681 pRS218_110 Hypothetical protein gcgttgcgccttacatcc tcacatcaccttccctttgatt 314
75360- 75647 pRS218_113 Hypothetical protein gagtacccgaaatatccacgtt taatctgacgcaggaactgttt 251
75360-75647 pRS218_113 Hypothetical protein tgggggctgaaaaccagaga accgaaggcacgaactgcat 531
75691- 76587 pRS218_114 Unknown tcggtattttccggtgataaac ataacctgcccgacaatatcac 359
77473- 76883 pRS218_116 X polypeptide aggccgggattacaaaatagat ccggtataaatccggtaaacct 354
78394 79080 pRS218_118 TraJ/conjugal transfer caatggggcttttattgaactc tgaccaacacccagcatataaa 369
85396- 85614 pRS218_131 Hypothetical protein tgcatacctttatttttcttgtgc tcagtgtatccatcacgttgttc 210
89620-90612 pRS218_136 TraU/conjugal transfer ttccttctcgccggtcatgt ccagcgagagcgggaaaata 111
105274- 110544 pRS218_154 TraI/conjugal transfer gcgatgcggtcagtgttctg ggacagccgttcatcctgct 190
111369- 112229 pRS218_156 Dienelactone hydrolase tctggttaccggagagatgaat agtaccagaagcaacagcatca 343
113415- 113939 pRS218_159 Hypothetical protein gtgccatttatctgatatggagaat tctgtgttgtactgctcatataccc 387
113985- 114194 pRS218_190 Hemolysin expression modulating protein caaaacaggaatggctgtatca tatttccatatctcttttggtatcctg 190