Skip to main content

Advertisement

Table 1 Bacterial strains, plasmids and primers

From: Genome-wide analysis of the PreA/PreB (QseB/QseC) regulon of Salmonella enterica serovar Typhimurium

Strains/Plasmids/Primers Description Source
E. coli   
DH5α supE44 Δ(lacZYA-argF) U169 (Δ80lacZ ΔM15) hsdR17 recA endA1 gyrA96 thi-1 relA1 Gibco
Salmonella enterica serovar Typhimurium   
JSG210 ATCC 14208 (CDC6516-60), wild type ATCC
JSG1998 JSG210 ΔpreA1998 [3]
JSG2343 JSG210 ΔpreB2343 [3]
JSG2626 JSG210 ΔpreAB2626 [3]
JSG1225 fliA::Tn10 dTet gift of K. Klose
JSG648 phoN::cam prgH1::TnphoA [7]
Plasmids   
PBAD18 ColE1 ori, pBAD L-Ara inducible (Apr) [9]
pRK2013::Tn7 ColE1 mob Δtra RK2 Δrep RK2 repE kan::Tn7 (Tpr Smr Spr) [8]
pJSG2558 PBAD18 with a 0.7-kb fragment containing preA expressed from pBAD (Apr) [3]
pJSG2581 PBAD18 with a 1.5-kb fragment containing preAB expressed from pBAD (Apr) [3]
Primers (5'-3')   
6-FAM-ccatcgccaataagtgtgtc preA Reverse (primer ext.) This study
6-FAM-cagggtgtcattcaactggc mdaB Reverse (primer ext.) This study
6-FAM-gatgacgctcaatgtggtcg STM3175 Reverse (primer ext.) This study
6-FAM-ttcgcaaactggtcgaggac ygiN Reverse (primer ext.) This study
6-FAM-tgatcacgtacatggagtag parC Reverse (primer ext.) This study
6-FAM-gtagaacacagtgccataac ygiW Reverse (primer ext.) This study
ggtagaacacagtgccataac preA F (primer ext.) This study
ctcggtaaaccagtcgacgc preA R (primer ext.) This study
ggaaggtggatttgaggc mdaB F (primer ext.) This study
gcagcttcaccgtcagagata mdaB F (primer ext.) This study
gacgatcttaacctgatgacc mdaB R (primer ext.) This study
cgaagtggataaagactggaac STM3175 F (primer ext.) This study
tagcgatagagcggaagc STM3175 R (primer ext.) This study
gcgtctatctgccattcc ygiN F (primer ext.) This study
gcggcatgatccaccatc ygiN R (primer ext.) This study
cctgaatttcgtccatgagg parC F (primer ext.) This study
gaatagcgagattcctggcg parC F (primer ext) This study
ccagctctgacatcgcatag parC R (primer ext.) This study
ccatcgccaataagtgtgtc ygiW F (primer ext.) This study
cgtcacgcagcgatttagc ygiW R (primer ext.) This study
ggccgaacactctttgtggt dnaN F (real-time) This study
gtataatttcggtcgcatccgt dnaN R (real-time) This study
atatcgtcgagcgcatttcc ygiW F (real-time) This study
tccagtctttatccacttcgcc ygiW R (real-time) This study
aagagttcgcgttgctggaa (JG1134) preA F (real-time, RT-PCR) This study
gagcttgcggcgtaaatgat preA R (real-time) This study
agactctggcgcctgactcg ygiN F (real-time) This study
aacgccggattccagaatacg ygiN R (real-time) This study
acaggcttaagagtagcggctg (JG1137) preB R (RT-PCR) This study
atatcgtcgagcgcatttcc (JG1132) ygiW F (RT-PCR) This study
cgcggatccttaacgaagcggcagatagatatc (JG1223) STM 3175 R(RT-PCR) This study
gtgtcgtttggcaacgccgcggaa (JG1703) preB F(RT-PCR) This study
caactggccgttggagtgcgcg (JG1704) mdaB R (RT-PCR) This study
tgccggatgttccgcgctataccgca (JG1705) mdaB F (RT-PCR) This study
tgacggtgatgttggcccggacgcg (JG1706) ygiN R (RT-PCR) This study
gaagccgtccagcagttg (JG1861) STM 1595 F (Real-time PCR) This study
gcgataaccattccaccaaac (JG1862) STM 1595 R (Real-time PCR) This study
cgttcctaaacttgcgttacag (JG1863) STM 3175 F (Real-time PCR) This study
gctggcgttgaccttatcc (JG1864) STM 3175 R (Real-time PCR) This study
ttgtatctggagattgtggactac (JG1865) STM 1685 F (Real-time PCR) This study
gagcccgtcgcaaagttg (JG1866) STM 1685 R (Real-time PCR) This study
tctacgcttgttcgcttac (JG1867) STM 1252 F (Real-time PCR) This study
ggtgttgtccagatattatgttc (JG1868) STM 1252 R (Real-time PCR) This study
tacagtggacaatgaatg (JG1869) STM 1684 F (Real-time PCR) This study
gctatggctatgtaacag (JG1870) STM 1684 R (Real-time PCR) This study
ggcttcacggcggcaatg (JG1871) STM 2080 F (Real-time PCR) This study
tcacgatacgggagggataaagg (JG1872) STM 2080 R (Real-time PCR) This study
ctaacttccaggaccactc (JG1873) STM 4118 F (Real-time PCR) This study
gataaccgtacagactcatac (JG1874) STM 4118 R (Real-time PCR) This study
tgatatgggcgttctggtctg (JG1875) STM 1253 F (Real-time PCR) This study
cgtgctgccagtgaggag (JG1876) STM 1253 R (Real-time PCR) This study