Skip to main content

Table 3 Sequences of oligos used for amplification in qRT-PCR

From: Short hairpin RNA-mediated knockdown of protein expression in Entamoeba histolytica

Oligo Name Oligo Sequence mRNA/cDNA section amplified (bp from ATG) Total length of mRNA (bp)
Igl 5' F GCTGTTCCACATTGTGCATCAGTTTCAAATG 85–450 (Igl1), 85–459 (Igl2) 3306 (Igl1), 3318 (Igl2)
Igl 5' R TTCTGCATGATCTTCTGTAGTTGCATTATCACATAAC   
Igl 3' F TGAAGGCACTTCTACAGAAGATAATAAAAT 2967–3166 (Igl1), 2979–3178 (Igl2)  
Igl 3' R TATGTCTTGAACATGGAATACATGATC   
Igl1 F TCTTGTAATAAGTTCCCGGAGCA 634–841 (Igl1)  
Igl1 R CATCAGAAACAGTACATCTTTTATTACATG   
Igl2 F GTACTAAATACCCAGATCATTGTTCAAA 643–841 (Igl2)  
Igl2 R CATCAGAAACAGTACATCTTTTATTACATG   
URE3-BP 5' F CCTGTAGCTAATTTCTGTTTATGGAATC 10–155 663
URE3-BP 5' R CTTGTATATTGATCTAATGGGATAGTGTTAAG   
URE3-BP Middle F GATGAGAATTTTTGATACTGATTTTAATGGAC 276–454  
URE3-BP Middle R GATTAATATAGAATCCAAGTTGTTGAAGAG   
URE3-BP 3' F CTGTGATCTTAATTGTTGGATTG 504–658  
URE3-BP 3' R CCAAGAGGGAAGTAACAACGT   
Actin F GCACTTGTTGTAGATAATGGATCAGGAATG variable (detects all family members/alleles) variable
Actin R ACCCATACCAGCCATAACTGAAACG   
Jacob F CAAAGGAGTTCAAATGGGATGTGTTAG variable (detects all family members/alleles) variable
Jacob R TTATTTGGTGTAGGAGTTGGTAATGGG   
  1. Oligo pairs were designed to amplify short sections of Igl or URE3-BP. For Igl, four pairs of oligos were used: one amplifying the 5' end (Igl 5' oligo pair) and one the 3' end (Igl 3' oligo pair) of Igl1 and Igl2 simultaneously; and a pair each to amplify a short section unique to Igl1 or Igl2 (Igl1 oligo pair and Igl2 oligo pair, which have the same reverse primer in common) near the 5' end of the mRNA. Three oligo pairs were used to amplify short sections of URE3-BP: one pair the 5' end, one pair the middle, and one pair the 3' end. The actin and Jacob primers were designed to amplify all family members or alleles [35].