Skip to main content

Table 4 The PCR primers for PCR and size of PCR products

From: Clonal dissemination of the multi-drug resistant Salmonella enterica serovar Braenderup, but not the serovar Bareilly, of prevalent serogroup C1 Salmonella from Taiwan

Primer Target DNA sequence (5' to 3') Product Sizesize Note
CS-F CS region GGCATCCAAGCAGCAAG Variable (47)
1.9CS-F Flanking region of CS region CTGCTGCGTAACATCGTTGCT Variable This study
ColE1-F ColE1 ori T CAAATGCTGTCCTTCCAGTGT 225 bp This study
F-F IncFI ori T CAACAACGCGCCGACACCGT 288 bp This study
R100-F IncF2 ori T CCACCAAAAGCACCACACACT 266 bp This study
pSC138-F IncI ori T TGTCACGAACATCTGCCAGT 193 bp This study
IS26out-F Variable GCTAACTTTGCAACAGTGCC Variable DQ390455.1