Skip to main content

Advertisement

Table 4 The PCR primers for PCR and size of PCR products

From: Clonal dissemination of the multi-drug resistant Salmonella enterica serovar Braenderup, but not the serovar Bareilly, of prevalent serogroup C1 Salmonella from Taiwan

Primer Target DNA sequence (5' to 3') Product Sizesize Note
Tem-F bla TEM GAAGATCAGTTGGGTGCACGAGT 550 bp This study
Tem-R   CAACTTTATCCGCCTCCATCCAGT   
STR-F1 aadA2 AGACGCTCCGCGCTATAGAAGT 203 bp (46)
STR-R1   CGGACCTACCAAGGCAACGCT   
CS-F CS region GGCATCCAAGCAGCAAG Variable (47)
CS-R   AAGCAGACTTGACCTGA   
1.9CS-F Flanking region of CS region CTGCTGCGTAACATCGTTGCT Variable This study
1.9CS-R   GGCGAGATCATCAAGTCAGT   
ColE1-F ColE1 ori T CAAATGCTGTCCTTCCAGTGT 225 bp This study
ColE1-R   CTCAGTTCGGTGTAGGTCGT   
F-F IncFI ori T CAACAACGCGCCGACACCGT 288 bp This study
F-R   CCCTTCCTGTCGACGCTTCT   
R100-F IncF2 ori T CCACCAAAAGCACCACACACT 266 bp This study
R100-R   AGACACTCCTAGCAGCGCCT   
pSC138-F IncI ori T TGTCACGAACATCTGCCAGT 193 bp This study
pSC138-R   GAGAGAAAGTGCCCATGGCT   
IS26in-F IS 26 GGCACTGTTGCAAAGTTAGC 820 bp DQ390455.1
IS26in-R   GGCACTGTTGCAAATAGTCG   
IS26out-F Variable GCTAACTTTGCAACAGTGCC Variable DQ390455.1
IS26out-R   CGACTATTTGCAACAGTGCC   
Tn-F Tn ACCTAGATTCTACGTCAGTAC Variable (35)
AmpC-F AmpC CAAGTTTGATTCCTTGGACTCT   AY253913
AmpC-R   CTCATCGTCAGTTATTGCAGCT   
SugE-R sugE GCCTGATATGTCCTGGATCGT