Skip to main content

Table 1 Oligonucleotide primers and fluorescent probes used in RT-PCR

From: Involvement of SPI-2-encoded SpiC in flagellum synthesis in Salmonella enterica serovar Typhimurium

Target gene Nucleotide sequence (5'-3')
fliD CGCGAAGCTGAACGTAAACG
  GCGTCGGTTACGGTATTGC
  6-FAM-TCTGACGCTCAATGTC
motA GCTTTCATGGGTTTCAATCTCTTCA
  CAGCGGCAACATGAATACGTT
  6-FAM-TCAACGCTTCAATTTC
fliA TCGATGCTATCGCCATGCT
  TTGCGGAGTATCGTCAGATGTT
  6-FAM-CGCCACTCATCGTAAGA
fliF GCAGACGGAAGAGCACTACAG
  GCCTACCTGTTCGCTAATATTCAAC
  6-FAM-TCGAAGGCCACTCTGC
flgB CGTCGCGTTAACGTTGACTTC
  TCCACTGCGGGAGAAGAGA
  6-FAM-CTCTCACCATATTCCC
flhD TGATGATCGTCAAACCGGAAA
  TGCCGCAGATGGTCAAACTG
  6-FAM-AACTAACTGGTTCGTCTCC
16S rRNA AGATGGGATTAGCTTGTTGGTGA
  GTAACGTCAATGCTGCGGTTA
  6-FAM-CCACAACACCTTCCTC
  1. Fluorescent probes are shown in italic.