Skip to main content

Advertisement

Table 1 Primers and probe used in this study.

From: The mycobacterial DNA-binding protein 1 (MDP1) from Mycobacterium bovis BCG influences various growth characteristics

Gene Primer pair, probe Sequences of primers and probesa References accession no.
MDP1 MDAS11
MDAS2
GGG AAGCTT CGGAGGGTTGGGATGAACAAAGCAGA
GTG CTGCAG ACGCACAATCGTGTCAACGACATT
GenBank: AB013441
aph Tn903/S1
Tn903/AS1
CGA GGC CGC GAT TAA ATT CCA AC
TGA GTG ACG ACT GAA TCC GGT GAG A
GenBank: DQ115380
MDP1 antisense construct MDAS1
pMV261FW
GAA TTC GGA GGG TTG GGA TGA ACA AAG CAG A
GAG GAA TCA CTT CGC AAT GGC
This study
85B antigen MY85FW
MY85BW
85Bprobe
TCAGGGGATGGGGCCTAG
GCTTGGGGATCTGCTGCGTA
(FAM)-TCGAGTGACCCGGCATGGGAGCGT-(TAMRA)
[20] [21]
  1. aRestriction sites added to the primers for cloning purposes are italicised and underlined.