Skip to main content

Table 4 Oligonucleotide primers used for plasmid profiling.

From: Assessment of decorin-binding protein A to the infectivity of Borrelia burgdorferi in the murine models of needle and tick infection

Primer Sequence Reference
lp54 5' ATGAGCAAAAAAGTAATTTTAATAT [55]
lp54 3' CACTAATTCTTTTTGAATTACTAAT [55]
cp26 5' ATGCCTCCAAAAGTGAAGATAAAAA [55]
cp26 3' TAGCTTATAATTAAAAATTATTGAT [55]
cp9 5' ATGCAAAAAATAAACATAGCTAAAT [55]
cp9 3' ATCTTCTTCAAGATATTTTATTATA [55]
lp17 5' GTGTATACTGACCCAAGGTCAATTA [55]
lp17 3' CAATAATGTGATATTTTTAAGAAAT [55]
lp25 5' AAATTAATTTCTTTGATCAACCAAC This study
lp25 3' TATATTAAGCTTACTTTGGCTGTCG This study
lp28-1 5' GATGCAGAGAAGGCTGCTGCTGCAGTTAGTGC This study
lp28-1 3' TATAAGCTTTCATCAGAGAGTCTTATTAACAGCAGTCTCAAC This study
lp28-2 5' ATGGCGCTGATTACATTAATTGTCG [55]
lp28-2 3' AATCTTGAAGAACCTTGCATCTTTA [55]
lp28-3 5' CTGAAAATGAAGGAGAAGCGGGTGG [55]
lp28-3 3' TAGGCTAATACCAATTCGTACAAAT [55]
lp28-4 5' ATGAAATGCCATATAATTGCAACTA [55]
lp28-4 3' AATCCGACAGATCTGGTTTGTCCAG [55]
lp38 5' ATGATTATTACCCAAACAACGCCC This study
lp38 3' TTTTAAATCCATTTTCACAATATG This study
lp36 5' TTCTTATCCCTGACTTTCACTTTTGAGG This study
lp36 3' TCCTTTACTTCTATGTTTTTACTTTCCTTGGT This study
lp5 5' ATGAATGGAATAATTAACGATACAC [55]
lp5 3' AATATTAGGATGAAGATTATAAATT [55]
lp21 5' TGTGGTTGCTAAAACCCAAGCGT This study
lp21 3' TTGTTTCTAATTGCTCTGAATTGCATCC This study
Chrom 5' GATTATCAATCATAATACATCAGC [55]
Chrom 3' TCTAAGCAATGACAAACATATTGG [55]
cp18-1 5' AGGGGAATGTATTAATTGATAATTCA This study
cp18-1 3' AGATTTTTTCAAAACATTTGGCGAT This study
cp18-2 5' TCAGAAAGCATACCATTACAAGACAAC This study
cp18-2 3' AATAATACCTTTTTCTACGCCCGATA This study
cp32-1 5' GTTATAATACCTATTCAAGCAGAAAGG This study
cp32-1 3' GCTCCCTTCTAATACTTTTCTATAA This study
cp32-2 5' CAAGCGAGTTTATTCCCCTTAAA This study
cp32-2 3' ATTCTAATATTGTCCACTTTATGAAAT This study
cp32-3 5' ACTTGCAAGAGCACAGGTCTATAATTA This study
cp32-3 3' CTTAATACAATTAACGTTTCCAGTATA This study
cp32-4 5' GTATAAATGCTTTTGGTTATAAGCACAC This study
cp32-4 3' GAAACTCCTTCTCTAACCTTTACATAC This study
cp32-5 5' GCCTTATAAGGAACATAGGTTAAAGG This study
cp32-5 3' AGATTTCAAGCGCTCCTTCAACAAA This study
cp32-6 5' GGTGCTTTAGACACAAGAGATGTG This study
cp32-6 3' GAACAAATTTCAGATTTAACATTTATCG This study
cp32-7 5' GTCAAATTTAAGCTGTTTTAGCAGTG This study
cp32-7 3' TATTTACTAATCTATTTTTCAATTTTTCA This study