Skip to main content

Table 3 Oligonucleotide primers used in this study.

From: Genomic, genetic and structural analysis of pyoverdine-mediated iron acquisition in the plant growth-promoting bacterium Pseudomonas fluorescens SBW25

Primer Sequence (5'-3')a Application
CM-030 GGGAGATCT AGGTCCACATTGGATTGCAGG pvdS promoter
CM-038 CCGCTCGAG GGTGAAGCGCCGTGAATAACCACA pvdS promoter
CM-036 GGAAGATCT CCTGTGGATACTTGTTCCGTCA pvdL promoter
CM-037 CCGCTCGAG ACCAAAGAACGCCGCGACGTAATC pvdL promoter
CM-050 GGAAGATCT CTGCTGGGCGTTGAGGGTCTGG fpvI promoter
CM-051 CCGCTCGAG CGGGAAATGCACAGGCGTTCGGCA fpvI promoter
CM-052 GGAAGATCT CGTCTGCAGCGTCTGGTCCTGGAG fpvR promoter
CM-053 CCGCTCGAG GTCCTTGTAGTTGCTGTAGACCAG fpvR promoter
CM-116 GGGAGATCT GAAGTAGGAACGTGTCACTAGTGG fpvA promoter
CM-117 GGGCTCGAG GTCGAAGTGCCTGCCAGCAAG fpvA promoter
CM-110 CACC GTGTAGGAGGCCTCAGCAAGG pvdS ORF
CM-111 ACATAAGGCGCACATTTCATCTGC pvdS ORF
CM-112 CACC ACTCAGGGACCTAATGCCGC fpvI ORF
CM-113 CATGTGTTGATAGGAAACGAGGAC fpvI ORF
CM-114 CACC CGTGAAGTTAGAATGTGGG fpvR ORF
CM-115 TGGGCGGTTCAGGGCATG fpvR ORF
pvdL1 GAAGATCT TCGAACTTCCCCAAACGCT pvdL deletion
pvdL2 CAGCATGCGGATCCGTTGACGGA ACCCGCAGCGCGGGGATGCC pvdL deletion
pvdL3 TCCGTCAACGGATCCGCATGCTG TGGCGCACCAATGGCTGCT pvdL deletion
pvdL4 GAAGATCT CCAACTCCGCCATCAAATCA pvdL deletion
  1. a Underlined sequences denote Bgl II or Xho I restriction sites to facilitate cloning; sequences in bold type are tag for directional topoisomerase-mediated cloning, and sequences in italics denote random complementary sequences to facilitate SOE-PCR [50].